View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4706_low_2 (Length: 251)
Name: NF4706_low_2
Description: NF4706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4706_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 3632367 - 3632603
Alignment:
| Q |
1 |
ttcaattttattttcacccgttacattttagtttatcattcaattctgatagtcccttgtgattgttatattagttacattttttgctgacaccttctct |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3632367 |
ttcaatttgattttcacccgttacattttagtttatcattcaattctgatagtcccttgtgattgttatattagttacattttttgctgacaccttctct |
3632466 |
T |
|
| Q |
101 |
tctttgaaacgaacaaggatttggcaccttctccaaaatatggtattgatgtcaaagacgtcgatgtattatcaagggaagaaggtggttacaggagttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3632467 |
tctttgaaacgaacaaggatttggcaccttctccaaaatatggtattgatgtcaaagacgtcgatgtattatcaagggaagaaggtggatacaggagttg |
3632566 |
T |
|
| Q |
201 |
ccatttattcttatctggaagtgatagttcatctctc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3632567 |
ccatttattcttatctggaagtgatagttcatctctc |
3632603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University