View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4708_high_2 (Length: 313)

Name: NF4708_high_2
Description: NF4708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4708_high_2
NF4708_high_2
[»] chr4 (1 HSPs)
chr4 (31-292)||(37604472-37604733)
[»] chr7 (1 HSPs)
chr7 (169-228)||(8178921-8178980)


Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 31 - 292
Target Start/End: Complemental strand, 37604733 - 37604472
Alignment:
31 gagaagaaatccgcaacttagcattaaccaattcagacggagcagataagttaatatggaaattcattaacaaagggcattatacagtgaagtctgcata 130  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
37604733 gagaagaaatccgcaacttagcattaaccaattcagacggagcagataagttaatatggaaattcattaacaaagggcattatacagcgaagtctgcata 37604634  T
131 catgtatgatatggaaactctcattgataatgtggagtatagaatgccgggagattggatgagaatgtggaatctgcacatacctcaacggatcaaagnn 230  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||      
37604633 catgtatgatatggaaactctcattcataatgtggagtatagaatgccgggagattggacgagaatgtggaatctgcacatacctcaacggatcaaagtt 37604534  T
231 nnnnnatggagtttgttgaggggtgtactcccttcgcatatatgagacttcaaggaaggggg 292  Q
         |||||| |||||||||||||| |||||||||||||||| ||||||||||||||||||    
37604533 tttttatggaggttgttgaggggtgttctcccttcgcatatataagacttcaaggaaggggg 37604472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 169 - 228
Target Start/End: Complemental strand, 8178980 - 8178921
Alignment:
169 atagaatgccgggagattggatgagaatgtggaatctgcacatacctcaacggatcaaag 228  Q
    ||||| || |||| ||||||||||||||||||||||| || ||||||||| |||||||||    
8178980 atagagtgtcgggtgattggatgagaatgtggaatcttcatatacctcaaaggatcaaag 8178921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University