View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4709-Insertion-3 (Length: 445)
Name: NF4709-Insertion-3
Description: NF4709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4709-Insertion-3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 318; Significance: 1e-179; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 6 - 335
Target Start/End: Original strand, 120564 - 120893
Alignment:
| Q |
6 |
cagatatatggtctttgggatgtactgttattgaaatggccactggcaggcctccttgggacgacgatgacctcatttccatttcaaatccaatggctgc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
120564 |
cagatatatggtctttgggatgtactgttattgaaatggccactggcaggcctccttgggtcgatgatgacctcatttccatttcaaatccaatggctgc |
120663 |
T |
|
| Q |
106 |
tatgtttaagattgcatgtggtgatgggatacctcaatttccaattcacttctctcaggatggtttcgatttcttgaggaggtgtttggtgagagatccc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
120664 |
tatgtttaagattgcatgtggtgatgggatacctcaatttccaattcacttctctcaggagggtttcgatttcttgaggaggtgtttggtgagagatccc |
120763 |
T |
|
| Q |
206 |
aaaaagaggtctaccgcactggagttgcttaaccatccatttcttgtttcaactactttaactcatcacaaacactactctgcttcctcgcccgcatctg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
120764 |
aaaaagaggtctaccgcactggagttgcttaaccatccatttcttgtttcaactactttaactcatcacaaacactactctgcttcctcgcccgcatctg |
120863 |
T |
|
| Q |
306 |
tcttggaggttcatcagtttgaggatacat |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
120864 |
tcttggaggttcatcagtttgaggatacat |
120893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 382 - 445
Target Start/End: Original strand, 120937 - 121000
Alignment:
| Q |
382 |
attaataagtccggcaggagggaatcatttcttcatcacaaaagagcttctgtgcccacaagga |
445 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
120937 |
attaataagtccagcaggagggaatcatttcttcatcacaaaagagcttctgtgcccacaagga |
121000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University