View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4709-Insertion-4 (Length: 391)
Name: NF4709-Insertion-4
Description: NF4709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4709-Insertion-4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 7e-96; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 7e-96
Query Start/End: Original strand, 69 - 254
Target Start/End: Original strand, 35059011 - 35059196
Alignment:
| Q |
69 |
gtagcagttgagattgaaggatatgggagaccaacttcaccttcggtgccttttccgactttgatttctatgctttccaaggtttcgccacaacttgata |
168 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35059011 |
gtagcggttgagattgaaggatatgggagaccaacttcaccttcggtgccttttccgactttgatttctatgctttccaaggtttcgccgcaacttgata |
35059110 |
T |
|
| Q |
169 |
ttgccctgatttgcaagttctataaagctagaaaggtaagtgttggttttgcttcctacttgcatattggtttaagagtcttgata |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35059111 |
ttgccctgatttgcaagttctataaagctagaaaggtaagtgttggttttgcttcctacttgcatattggtttaagagtcttgata |
35059196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 288 - 391
Target Start/End: Original strand, 35059230 - 35059333
Alignment:
| Q |
288 |
atcacttgctctatttcttgcaggaaaagaagatttcccgacatgaattgatagaaaaagtgagacaaattgcaggagacaagttgctgttttcaatcat |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35059230 |
atcacttgctctatttcttgcaggaaaagaagatttcccgacatgaattgatagaaaaagtgagacaaattgcaggagacaagttgctgttttcaatcat |
35059329 |
T |
|
| Q |
388 |
taag |
391 |
Q |
| |
|
|||| |
|
|
| T |
35059330 |
taag |
35059333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 35058951 - 35058992
Alignment:
| Q |
8 |
tgtttttcttaatgttgttttatgaatttagtcattgatgtg |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35058951 |
tgtttttcttaatgttgttttatgaatttagtcattgatgtg |
35058992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 381
Target Start/End: Original strand, 43897918 - 43897991
Alignment:
| Q |
308 |
caggaaaagaagatttcccgacatgaattgatagaaaaagtgagacaaattgcaggagacaagttgctgttttc |
381 |
Q |
| |
|
||||| ||||||||||| ||||||||| ||||| ||||||| ||| || ||||||| ||||| ||| ||||||| |
|
|
| T |
43897918 |
caggataagaagatttcgcgacatgaaatgatacaaaaagttagaaaagttgcaggtgacaaattgttgttttc |
43897991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University