View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4709-Insertion-6 (Length: 71)
Name: NF4709-Insertion-6
Description: NF4709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4709-Insertion-6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 51; Significance: 6e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 17 - 71
Target Start/End: Complemental strand, 37604468 - 37604414
Alignment:
| Q |
17 |
ccttcttcggactactgcccctgctgtgagaccaattatgagaatgattggcaca |
71 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37604468 |
ccttcttcggactactgccccttctgtgagaccaattatgagaatgattggcaca |
37604414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 70
Target Start/End: Complemental strand, 8178832 - 8178803
Alignment:
| Q |
41 |
tgtgagaccaattatgagaatgattggcac |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8178832 |
tgtgagaccaattatgagaatgattggcac |
8178803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University