View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4709-Insertion-8 (Length: 263)
Name: NF4709-Insertion-8
Description: NF4709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4709-Insertion-8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 19 - 122
Target Start/End: Original strand, 23971562 - 23971666
Alignment:
| Q |
19 |
ttgcatgtttg-acgacaactatatgcacgatgaggaacgaatgatttataacccttggatgaatcatgtacagcacttcccttgttgtaatattgtttt |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23971562 |
ttgcatgtttgcacgacaactatatgcacgatgaggaacgaatgatttataacccttggatgaatcatgtacagcactgcccttgttgtaatattgtttt |
23971661 |
T |
 |
| Q |
118 |
aagac |
122 |
Q |
| |
|
||||| |
|
|
| T |
23971662 |
aagac |
23971666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 131 - 182
Target Start/End: Original strand, 23971696 - 23971753
Alignment:
| Q |
131 |
aagtaatcaaaagatgtcatttt------tgtttacaaaaatgtgtaattataacttt |
182 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23971696 |
aagtaatcaaaagatgtcatttttgtttttgtttacaaaaatgtgtaattataacttt |
23971753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University