View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4709_high_5 (Length: 284)
Name: NF4709_high_5
Description: NF4709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4709_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 20817945 - 20818199
Alignment:
| Q |
1 |
ttttcttattcttagcgccgtagtccttaagtgacattgtcgttttctaagagtttgctatcgtgatttctctgtctctatgattttgttttggagaagt |
100 |
Q |
| |
|
||||||| ||| |||||| ||||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20817945 |
ttttctttttcaaagcgccatagtccttaagtgacattgtcgtttcctaagagtttgctatggtgatttct--gtctctatgattttgttttggagaagt |
20818042 |
T |
|
| Q |
101 |
atgaaatcaaatgatttttgtctttagttgctatgttttctgcaaaaagaaaatttattctgcagaggcaatcgttttttcaccgtaagtttgatttttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20818043 |
atgaaatcaaatgatttttgtctttagttactatgttttctgcaaaaagaaaatttattctgcagatgcaatcgttttttcaccgtaagtttgatttttc |
20818142 |
T |
|
| Q |
201 |
cttttacaagaaaagaattcgaaaggtatgcctgcatcacatgctcttatgttttct |
257 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
20818143 |
cttttacaagaaaagaatttgaaaggtatgcctgcatcacatactcttctgttttct |
20818199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University