View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4709_high_8 (Length: 247)

Name: NF4709_high_8
Description: NF4709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4709_high_8
NF4709_high_8
[»] chr2 (1 HSPs)
chr2 (22-189)||(19175785-19175952)


Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 22 - 189
Target Start/End: Complemental strand, 19175952 - 19175785
Alignment:
22 tctactgttgattctggcaacaacaactatatagatactattcctgagaacaaagcagattgtaaaccatatggacaaaatggggttttcgataaaccca 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19175952 tctactgttgattctggcaacaacaactatatagatactattcctgagaacaaagcagattgtaaaccatatggacaaaatggggttttcgataaaccca 19175853  T
122 ccggacgattctcagatggccgcattattaccgattttataggtatatgacatactactgtgcctatc 189  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| || ||||||||    
19175852 ccggacgattctcagatggccgcgttattaccgattttataggtatataacatactgctatgcctatc 19175785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University