View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4709_high_8 (Length: 247)
Name: NF4709_high_8
Description: NF4709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4709_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 22 - 189
Target Start/End: Complemental strand, 19175952 - 19175785
Alignment:
| Q |
22 |
tctactgttgattctggcaacaacaactatatagatactattcctgagaacaaagcagattgtaaaccatatggacaaaatggggttttcgataaaccca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19175952 |
tctactgttgattctggcaacaacaactatatagatactattcctgagaacaaagcagattgtaaaccatatggacaaaatggggttttcgataaaccca |
19175853 |
T |
 |
| Q |
122 |
ccggacgattctcagatggccgcattattaccgattttataggtatatgacatactactgtgcctatc |
189 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| || |||||||| |
|
|
| T |
19175852 |
ccggacgattctcagatggccgcgttattaccgattttataggtatataacatactgctatgcctatc |
19175785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University