View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4709_low_10 (Length: 238)
Name: NF4709_low_10
Description: NF4709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4709_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 72 - 222
Target Start/End: Complemental strand, 2600446 - 2600296
Alignment:
| Q |
72 |
tgtgtttggattaatagttggcttgtaattattatgtgcataataatagttgtgtttaaacatcaatagtaacataaaattatagaatcgaaaataaaat |
171 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2600446 |
tgtgtttggattaattgttggcttgtaattattatgtgcataataatagttgtgtttaaacatcaatagtaacataaaattatagaatcgaaaataaaat |
2600347 |
T |
|
| Q |
172 |
acaataaactcgatcgatctttgttaacaccttttggttaatggtgtttat |
222 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2600346 |
acaataaactcgatcgatctttcttaacaccttttggttaatggtgtttat |
2600296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 2600515 - 2600466
Alignment:
| Q |
1 |
attttagctctctgtttctacttttgctcttttgtgtctcagtttatagc |
50 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2600515 |
attttagctctctgtttttacttttgctcttttgtgtctcagtttatagc |
2600466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University