View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4709_low_11 (Length: 225)

Name: NF4709_low_11
Description: NF4709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4709_low_11
NF4709_low_11
[»] chr4 (1 HSPs)
chr4 (20-208)||(31098883-31099072)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 20 - 208
Target Start/End: Original strand, 31098883 - 31099072
Alignment:
20 gttcgttgatcattttactagatataaatggatttatcccctaaaaagtaaaattgatgcttcttacatttcccccaacttttcacaaaagttagaacat 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||    
31098883 gttcgttgatcattttactagatataaatggatttatcccctaaaaagtaaaattgacgcttcttccatttcccccaacttttcacaaaagttagaacat 31098982  T
120 attttgcgcag-aattaaatccatttacactgacagtggcattgaatatttcaaattaaaaccatacttaaaatcacatggaatatctca 208  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31098983 attttgcgcagaaattaaatccatttacactgacagtggcattgaatatttcaaattaaaaccatacttaaaatcacatggaatatctca 31099072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University