View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4710-Insertion-18 (Length: 376)
Name: NF4710-Insertion-18
Description: NF4710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4710-Insertion-18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 5e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 8 - 161
Target Start/End: Original strand, 43879532 - 43879685
Alignment:
| Q |
8 |
cttattgaggtgtttgataaggtgagagaacacaaatgaaatgaagtcttaaaagatcttaaatttgtagcatatggcaaattaaaagtaattaattcaa |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
43879532 |
cttattaaggtgtttgataaggtgagagaacacaaatgaaatgaagtcttaaaagatcttaaatttgtagcatagggcaaaataaaagtaattaattcaa |
43879631 |
T |
|
| Q |
108 |
tgcgtacaaatacagggagagtatctcaactttattctgggcataaggttccaa |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43879632 |
tgcgtacaaatacagggagagtatctcaactttattctgggcataaagttccaa |
43879685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 220 - 293
Target Start/End: Original strand, 43879701 - 43879774
Alignment:
| Q |
220 |
gtcgtgtcgtgtgcatatttgaaatagaaatagaggcaccttcttaattggttattgtttcagtatggcatgtg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43879701 |
gtcgtgtcgtgtgcatatttgaaatagaaatagaggcaccttcttaattggttattgtttcagtatggcatgtg |
43879774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University