View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4710-Insertion-19 (Length: 152)
Name: NF4710-Insertion-19
Description: NF4710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4710-Insertion-19 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 9e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 9e-56
Query Start/End: Original strand, 8 - 152
Target Start/End: Original strand, 36435526 - 36435671
Alignment:
| Q |
8 |
gagagatcaatcaaaacaaaaataaaacgaagaagttgagtcttttcctccaaatcaatgacgactgggatttt-tattgtccgaaaggttatttttccc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || | ||||| ||||||||||||||||||||||||| |
|
|
| T |
36435526 |
gagagatcaatcaaaacaaaaataaaacgaagaagttgagtcttttcctccaaatcaatggcgcctagaattttttattgtccgaaaggttatttttccc |
36435625 |
T |
 |
| Q |
107 |
caaattctccatgacttttacattgttacgaactcgacatccatca |
152 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
36435626 |
caaattctcaatgacttttacattgttacaaactcaacatccatca |
36435671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University