View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4710-Insertion-8 (Length: 408)
Name: NF4710-Insertion-8
Description: NF4710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4710-Insertion-8 |
 | |
|
| [»] scaffold0259 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0259 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: scaffold0259
Description:
Target: scaffold0259; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 8 - 257
Target Start/End: Complemental strand, 18878 - 18629
Alignment:
| Q |
8 |
ccatctgcacgcaagttgtatgcattaattttaaaatgatagctaagcaaacttcttatattccatgtacttattcaatataacaaaaccctatgaatca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18878 |
ccatctgcacgcaagttgtatgcattaattttaaaatgatagctaagcaaacttcttatattccatgtacttattcaatataacaaaaccctatgaatca |
18779 |
T |
|
| Q |
108 |
catttctcttgaagctcacatgtgtcatattcaatacctatgagtaaggttgtcaaaattgggattttacttaagggcaaaagggaatcgcaatcaaaat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
18778 |
catttctcttgaagctcacatgtgtcatattcaatacctatgggtaaggttgttaaaattgggattttatttaagttcaaaagggaatcgcaatcaaaat |
18679 |
T |
|
| Q |
208 |
cgaaaaaatttactcaaactacatttatataattgatatgggccggacag |
257 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18678 |
cgaacaaatttactcaaactacatttatataattgatatgggccggacag |
18629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0259; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 338 - 408
Target Start/End: Complemental strand, 18548 - 18478
Alignment:
| Q |
338 |
ttgcatataatcctgactcaaatttaaagtgcacaaagcctagacaacctagacaaagcctagatgccaaa |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18548 |
ttgcatataatcctgactcaaatttaaagtgcacaaagcctagacaacctagacaaagcctagatgccaaa |
18478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 85 - 127
Target Start/End: Complemental strand, 31991578 - 31991536
Alignment:
| Q |
85 |
atataacaaaaccctatgaatcacatttctcttgaagctcaca |
127 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
31991578 |
atataacaaaaccctttgaatcacattcctcttgaagctcaca |
31991536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 153 - 195
Target Start/End: Complemental strand, 11879954 - 11879912
Alignment:
| Q |
153 |
aaggttgtcaaaattgggattttacttaagggcaaaagggaat |
195 |
Q |
| |
|
|||||||||||||| |||||||||||| ||| ||||||||||| |
|
|
| T |
11879954 |
aaggttgtcaaaatcgggattttacttcaggtcaaaagggaat |
11879912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 153 - 195
Target Start/End: Complemental strand, 11897370 - 11897328
Alignment:
| Q |
153 |
aaggttgtcaaaattgggattttacttaagggcaaaagggaat |
195 |
Q |
| |
|
|||||||||||||| |||||||||||| ||| ||||||||||| |
|
|
| T |
11897370 |
aaggttgtcaaaatcgggattttacttcaggtcaaaagggaat |
11897328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 151 - 200
Target Start/End: Complemental strand, 17811704 - 17811655
Alignment:
| Q |
151 |
gtaaggttgtcaaaattgggattttacttaagggcaaaagggaatcgcaa |
200 |
Q |
| |
|
|||||||||||||||| |||| ||||||| ||| ||||||||||| |||| |
|
|
| T |
17811704 |
gtaaggttgtcaaaatcgggactttacttcaggtcaaaagggaatagcaa |
17811655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University