View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4710-Insertion-9 (Length: 474)
Name: NF4710-Insertion-9
Description: NF4710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4710-Insertion-9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 179 - 467
Target Start/End: Original strand, 46892136 - 46892417
Alignment:
| Q |
179 |
gcactccacaacctcatcctctccatcctctccctcattatggctattggcacctccctcaccatcctaacccacacccccaacctccgctccaccacca |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46892136 |
gcactccacaacctcatcctctccatcctctccctcattatggctattggcacctccctcaccatcctaactcacacccccaacctccgctccaccacca |
46892235 |
T |
|
| Q |
279 |
tctgtttccctcctcatacccctccaaatggtccccctcttcttttgggcctacatcttctacctctcaaaatatccttgaattctttgacactcctctt |
378 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| ||| | |
|
|
| T |
46892236 |
tatgtttccctcctcatacccctccaaatggt-cccctcttcttttgggcctacatcttctacctctcaaaatat-cttgaattcattgacact-ctc-t |
46892331 |
T |
|
| Q |
379 |
tcataatcctatcaagatccatcaaacgccctctcaattcctccacgtgtaccatcattcaaccgtccccagtcatgtgttatctatgg |
467 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46892332 |
tcatcatcctatcaagatccatcaaacg-cctctc-attcctccacgtgtaccatcattcaaccgt-cccagtcatgtgttatctatgg |
46892417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 7 - 73
Target Start/End: Original strand, 46891964 - 46892030
Alignment:
| Q |
7 |
acattgactagtctaccatccaaacattctaaatttcacatggaaccctcctcacactccagcctca |
73 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46891964 |
acattggctagtctaccatccaaacattctaaatttcacatggaaccctcctcacactccagcctca |
46892030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University