View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4710_high_9 (Length: 262)
Name: NF4710_high_9
Description: NF4710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4710_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 18 - 255
Target Start/End: Original strand, 55138636 - 55138873
Alignment:
| Q |
18 |
aaatgcaggacccggtacgaatggatcgcagttctttatatgcacggcgaagacggagtggcttgacgggaagcatgtggtttttggtgaggtggttgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55138636 |
aaatgcaggacccggtacgaatggatcgcagttctttatatgcacggcaaagacggagtggcttgacgggaagcatgtggtttttggtgaggtggttgaa |
55138735 |
T |
 |
| Q |
118 |
ggaatggaggtggtgaaagtgattgagaaagttggttccggttcgggaaaaacatcaaagccagtggttattgctgactgcggccaactctctgatgata |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55138736 |
ggaatggaggtggtgaaagagattgagaaagttggttccggttcgggaaaaacatcaaagccagtggttattgctgactgcggccaactctctgatgata |
55138835 |
T |
 |
| Q |
218 |
atcatcttaataaccaacaacatatataacatgatgat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
55138836 |
atcatcttaataaccaacaacatatatagcatgatgat |
55138873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 40 - 182
Target Start/End: Complemental strand, 28754431 - 28754289
Alignment:
| Q |
40 |
ggatcgcagttctttatatgcacggcgaagacggagtggcttgacgggaagcatgtggtttttggtgaggtggttgaaggaatggaggtggtgaaagtga |
139 |
Q |
| |
|
||||| |||||||| || ||||| || ||||| ||||||||||||||||| || || || || ||| |||| |||||||| |||| | ||||| | || |
|
|
| T |
28754431 |
ggatctcagttcttcatctgcaccgctaagaccgagtggcttgacgggaaacacgtcgtgttcggtcaggttgttgaaggtctggacatcgtgaaggaga |
28754332 |
T |
 |
| Q |
140 |
ttgagaaagttggttccggttcgggaaaaacatcaaagccagt |
182 |
Q |
| |
|
| ||||||||||| || || || ||||| || ||||||||||| |
|
|
| T |
28754331 |
tcgagaaagttggatctggatctggaaagacctcaaagccagt |
28754289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University