View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4710_low_12 (Length: 208)
Name: NF4710_low_12
Description: NF4710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4710_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 12 - 191
Target Start/End: Original strand, 27171933 - 27172112
Alignment:
| Q |
12 |
agcagcacagagctcagcaaagaatgttgtgcaggttccaaaattttcagcaaagaaaaccacaaattaacattacaatttctaaggatacctccaccaa |
111 |
Q |
| |
|
|||| |||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27171933 |
agcaacacaaagctcagctaagaatgttgtgcaggttccaaaattttcagcaaagaaaaccacaaattaacattacaatttctaaagatacctccaccaa |
27172032 |
T |
 |
| Q |
112 |
cagatgaagttgaagttgaagctccgtttgtgttgcacttcatccaattggagatgaggggaatgccataggacctcttt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27172033 |
cagatgaagttgaagttgaagctccgtttgtgttgcacttcatccaattggagatgaggggaatgccataggacctcttt |
27172112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University