View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4711-Insertion-10 (Length: 142)
Name: NF4711-Insertion-10
Description: NF4711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4711-Insertion-10 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| |
|
| [»] scaffold1343 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 98; Significance: 1e-48; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 9 - 142
Target Start/End: Original strand, 140972 - 141103
Alignment:
| Q |
9 |
tttttatcactttttcagtctctaattgtctaatttcagaaagnnnnnnnnntacactctaaaaaattgcggtaactagatacgactttaataaaagggc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
140972 |
tttttatcactttttcagtctctaattgtctaatttcagaaagaaaaaaa--tacactttaaaaaattgcggtaactagatacgactttaataaaagggc |
141069 |
T |
|
| Q |
109 |
taaccttgaaaaaatttacatatcaatattctcc |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
141070 |
taaccttgaaaaaatttacatatcaatattctcc |
141103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1343 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: scaffold1343
Description:
Target: scaffold1343; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 95 - 135
Target Start/End: Original strand, 1509 - 1549
Alignment:
| Q |
95 |
tttaataaaagggctaaccttgaaaaaatttacatatcaat |
135 |
Q |
| |
|
||||||||| | ||||||||||||||||| ||||||||||| |
|
|
| T |
1509 |
tttaataaacgtgctaaccttgaaaaaatgtacatatcaat |
1549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 95 - 135
Target Start/End: Original strand, 14505265 - 14505305
Alignment:
| Q |
95 |
tttaataaaagggctaaccttgaaaaaatttacatatcaat |
135 |
Q |
| |
|
||||||||| | ||||||||||||||||| ||||||||||| |
|
|
| T |
14505265 |
tttaataaacgtgctaaccttgaaaaaatgtacatatcaat |
14505305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University