View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4711-Insertion-11 (Length: 340)
Name: NF4711-Insertion-11
Description: NF4711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4711-Insertion-11 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 109 - 340
Target Start/End: Complemental strand, 28139331 - 28139100
Alignment:
| Q |
109 |
tgataatggtcaacggttatactttggagaatccgtatgtgatatatgaccaatgaccattccgaaacttccttcatatgttctctctctttcgtgatca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28139331 |
tgataatggtcaacggttatactttggagaatccgtatgtgatatatgaccaatgaccattccgaaacttccttcatatgttctctctctttcgtgatca |
28139232 |
T |
|
| Q |
209 |
ataataatttaataatcaactttgtatgtcacgaagttggtttaaaaattacacaatcatggtttgtttgtataggttgcagataaagttttgatctact |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28139231 |
ataataatttaataatcaactttgtatgtcacgaagttggtttaaaaattacacaatcatggtttgtttgtataggttgcagataaagttttgatctact |
28139132 |
T |
|
| Q |
309 |
ccctccgtcaatatttataataccttttgtca |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28139131 |
ccctccgtcaatatttataataccttttgtca |
28139100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 8 - 59
Target Start/End: Complemental strand, 28139432 - 28139381
Alignment:
| Q |
8 |
gtatgtgaagccataggagaaagaagtagaagaagaaggtggttgcaaagcc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28139432 |
gtatgtgaagccataggagaaagaagtagaagaagaaggtggttgcaaagcc |
28139381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University