View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4711_low_11 (Length: 240)
Name: NF4711_low_11
Description: NF4711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4711_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 2644527 - 2644395
Alignment:
| Q |
1 |
tgaagcaactgttacagtgtatttaactcattttaataaaatc---gaattgtaatgtgagtaagatcactttttattctgatggtggcccaaatgaata |
97 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2644527 |
tgaagcaactcttatagtgtatttaactcatttttataaaatctaggacttgtaatgtgagtaagatcactttttattctgatggtggcccaaatgaata |
2644428 |
T |
|
| Q |
98 |
aagtgtgatatcatattaagtttttatatttga |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2644427 |
aagtgtgatatcatattaagtttttatatttga |
2644395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 122 - 220
Target Start/End: Complemental strand, 2644372 - 2644273
Alignment:
| Q |
122 |
tatatttgacctaattaatcattacaaaagtgacttgcaaaat-aggaatgccactattgataaatgtttttctgaatttatctattttcaacataggat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2644372 |
tatatttgacctaattaatcattacaaaagtgacttgtaaaatgaggaatgccactattgataaatgtttttctgaatttatctattttcaacataggat |
2644273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University