View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4711_low_12 (Length: 237)
Name: NF4711_low_12
Description: NF4711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4711_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 36202293 - 36202486
Alignment:
| Q |
1 |
aatgttattatgttttatgcacctgtgttttttaattccattgggtttaaggatgatgctgcccttatgtctgctgtcatcactggtgttgttaatgttg |
100 |
Q |
| |
|
|||||||| |||||||||||||||||| | ||||||||||||||||||||||| |||||| | |||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
36202293 |
aatgttatcatgttttatgcacctgtgctatttaattccattgggtttaaggacgatgcttcacttatgtcggctgtcatcaccggtgttgttaatgttg |
36202392 |
T |
|
| Q |
101 |
ctgctacttgtgtctcaatttatggagttgataagtggggtaggagagcccttttccttgaaggtggagttcaaatgatcatatgtcaggtaac |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| ||||||| |||||||| |
|
|
| T |
36202393 |
ttgctacttgtgtctcaatttatggagttgataagtggggtaggagagcccttttccttgaaggtggtgctcaaatgctcatatgccaggtaac |
36202486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 35922765 - 35922572
Alignment:
| Q |
1 |
aatgttattatgttttatgcacctgtgttttttaattccattgggtttaaggatgatgctgcccttatgtctgctgtcatcactggtgttgttaatgttg |
100 |
Q |
| |
|
|||||||| |||||||||||||||||| | |||| ||| |||||||| |||||||||||||||||||||| |||| || ||||| |||||||||| | |
|
|
| T |
35922765 |
aatgttataatgttttatgcacctgtgctatttagttctgttgggtttgaggatgatgctgcccttatgtcatctgtgataactggcgttgttaatgctt |
35922666 |
T |
|
| Q |
101 |
ctgctacttgtgtctcaatttatggagttgataagtggggtaggagagcccttttccttgaaggtggagttcaaatgatcatatgtcaggtaac |
194 |
Q |
| |
|
|| ||| | ||||||||| ||||||||||| | |||||||||||||||||| ||||||||||| |||||||| |||| ||||||||||| |
|
|
| T |
35922665 |
ttggtaccattatctcaatttttggagttgatagattgggtaggagagccctttttcttgaaggtggccttcaaatgctcatttgtcaggtaac |
35922572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University