View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4712_low_4 (Length: 299)
Name: NF4712_low_4
Description: NF4712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4712_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 41 - 282
Target Start/End: Complemental strand, 13479877 - 13479636
Alignment:
| Q |
41 |
gttaacagaaccatctagattctttgaagacaaatcatctaaagccagatctgccacgtcatcattttcacaaaagagatctcacccaagcaacgatgat |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13479877 |
gttaacagaaccatctagattctttgaagacaaatcatctaaagccagatctgccacgtcatcattttcacaaaagagatctcacccaagcaacgatgat |
13479778 |
T |
|
| Q |
141 |
tcagatgttcaacctcaaacaacgtcgtcagaagcaaaacgcgccgtgaatcgttgctccggttgtcggaagagagtcggtcttaccggattccgttgcc |
240 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13479777 |
tcaaatgttcaacctcaaacaacgtcgtcagaagcaaaacgcgccgtgaatcgttgctccggttgtcggaagagagtcggtcttaccggattccgttgcc |
13479678 |
T |
|
| Q |
241 |
gatgcggtgatcttttctgctccgagcatcgttactccgatc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13479677 |
gatgcggtgatcttttctgctccgagcatcgttactccgatc |
13479636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University