View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4713-Insertion-10 (Length: 300)
Name: NF4713-Insertion-10
Description: NF4713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4713-Insertion-10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 8 - 300
Target Start/End: Original strand, 26158354 - 26158645
Alignment:
| Q |
8 |
ctacaaaagcatcagagttttcccacgacacaccaagtatcagagctcaattctcactttagcaccgatacttttgattacagacgtatttggtgtgaga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||| ||||||||||| |||||||||||||||||||||| |||||| |||||||| ||| |
|
|
| T |
26158354 |
ctacaaaagcatcagagttttcccacgacacacccagcatcagagttcaattctcaccttagcaccgatacttttgattaaagacgtgtttggtgtcaga |
26158453 |
T |
 |
| Q |
108 |
cacggtgtgatcagttatgttannnnnnncaattgctaccggtgacggtgtgtcattgtcctgtttggtgttcatatttgtgtcattgtttcatagatta |
207 |
Q |
| |
|
||| |||||||||||||||||| |||||||||||| ||||| |||||||||||| |||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
26158454 |
cacagtgtgatcagttatgttatttttt-caattgctaccgttgacgatgtgtcattgtcgtgtttgatgtccgtatttgtgtcattgtttcatagatta |
26158552 |
T |
 |
| Q |
208 |
gcgtacactttttatcattatgcaattttattaatagttttctcataagttatgagtcataacacaccctatatcagagctcaatatttacaa |
300 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26158553 |
gcgtacattttttgtcattatgcaattttattaatagttttctcataagttatgagtcataacacaccctatatcagagctcaatatttacaa |
26158645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University