View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4713-Insertion-12 (Length: 170)
Name: NF4713-Insertion-12
Description: NF4713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4713-Insertion-12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 53 - 168
Target Start/End: Original strand, 3947021 - 3947136
Alignment:
| Q |
53 |
caatttagaaagaggtttatcaaccgttgaccggagccaccggttatgtttgactattattttcttatgtctgtaatttctatgttgtgttttcttctat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3947021 |
caatttagaaagaggtttatcaaccgttgaccggagccaccggttatgtttgactattattttcttatgtctgtaatttctatgtcatgttttcttctat |
3947120 |
T |
|
| Q |
153 |
gtttcaaatttttctc |
168 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3947121 |
gtttcaaatttttctc |
3947136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 7 - 36
Target Start/End: Original strand, 3946973 - 3947002
Alignment:
| Q |
7 |
agctcctccacaaaattgaatgcttcagca |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3946973 |
agctcctccacaaaattgaatgcttcagca |
3947002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University