View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4713-Insertion-14 (Length: 66)
Name: NF4713-Insertion-14
Description: NF4713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4713-Insertion-14 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 55; Significance: 2e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 8 - 66
Target Start/End: Complemental strand, 38701013 - 38700955
Alignment:
| Q |
8 |
tattcgtctttgcttctcgcaatttagatcttgctctttttcttcataacaatactcca |
66 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38701013 |
tattcgtctttgcttctcacaatttagatcttgctctttttcttcataacaatactcca |
38700955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 47
Target Start/End: Complemental strand, 38708691 - 38708651
Alignment:
| Q |
7 |
atattcgtctttgcttctcgcaatttagatcttgctctttt |
47 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
38708691 |
atattcgtctttgcttctcacagtttagatcttgctctttt |
38708651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University