View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4713-Insertion-6 (Length: 480)
Name: NF4713-Insertion-6
Description: NF4713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4713-Insertion-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 2e-65; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 8 - 138
Target Start/End: Complemental strand, 35327027 - 35326897
Alignment:
| Q |
8 |
gtttatgtcaaatcttgcaagtatgctggtgttgatactctcttgggagctactcaaattcttggtttgtttctcaacttttattttaacttctatctct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35327027 |
gtttatgtcaaatcttgcaagtatgctggtgttgatactctcttgggagctactcaaattcttggtttgtttctcaacttttattttaacttctctctct |
35326928 |
T |
|
| Q |
108 |
ctgcttaaactctattttcatgctaatgtag |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35326927 |
ctgcttaaactctattttcatgctaatgtag |
35326897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 342 - 480
Target Start/End: Complemental strand, 35326734 - 35326588
Alignment:
| Q |
342 |
agcatatagatctaaaatattattatagccgtagatctacgagattaatggctaagattctatgagatgacctattaactattccctttttag------- |
434 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |||||||||||||||||| |
|
|
| T |
35326734 |
agcatatagatctaaaatattattatagccgtagatctacgagattaatggctaagattctacgagacgacctaataactattccctttttaggtttatt |
35326635 |
T |
|
| Q |
435 |
-gtgatgttaggggtactctgggaaaaggttataaattcaaatccca |
480 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35326634 |
tgtgatgttaggggtactctaggaaaaggttataaattcaaatccca |
35326588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 178 - 292
Target Start/End: Complemental strand, 35326857 - 35326732
Alignment:
| Q |
178 |
atatctctcacttgtatcattttcatgttcatttttat-----------agatctattaagataataagcatttccactgtttaaactatgaatattgga |
266 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35326857 |
atatctctcagttgtatcattttcatgttcatttttatgttttttttctagatctattaagataattagcatttccactgtttaaactatgaatattgga |
35326758 |
T |
|
| Q |
267 |
tataaattagattcttaaactttagc |
292 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35326757 |
tataaattagattcttaaactttagc |
35326732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 8 - 88
Target Start/End: Original strand, 20964492 - 20964572
Alignment:
| Q |
8 |
gtttatgtcaaatcttgcaagtatgctggtgttgatactctcttgggagctactcaaattcttggtttgtttctcaacttt |
88 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| || || ||||||||| | | ||||||||||||||||||||||| |
|
|
| T |
20964492 |
gtttatgtcaaatcttgcaaccataatggtgttgacaccctaaagggagctacaccacttcttggtttgtttctcaacttt |
20964572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University