View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4713_high_3 (Length: 349)
Name: NF4713_high_3
Description: NF4713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4713_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 1 - 335
Target Start/End: Complemental strand, 41544440 - 41544106
Alignment:
| Q |
1 |
tgatatcctatcttttacatagacaatatttgattctttttcttcaaaaccaagaccatattttcatcatttatgccaacttcatagatcattggtgctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41544440 |
tgatatcctatcttttacatagacaatatttgattctttttcttcaaaaccaagaccatattttcatcatttatgccaacttcatagatcattggtgctt |
41544341 |
T |
|
| Q |
101 |
gcttctatttatatggtttgcaagaaatttttgggatgctccctcatattttgaggagttgcattcatttgactttgataaacttgggagtattattatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41544340 |
gcttctatttatatggtttgcaagaaatttttgggatgctccctcatattttgaggagttgcattcatttgactttgataaacttgggagtattattatt |
41544241 |
T |
|
| Q |
201 |
ataacgtcgattatcctttctcaaagcttcacattcattatgttcaaataataaccttttgtaactttcaaccaaatgtttgctcgtgtttcaaattatt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41544240 |
ataacgtcgattatcctttctcaaagcttcacattcattatgttcaaataataaccttttgtaactttcaaccaaatgtttgctcgtgtttcaaattatt |
41544141 |
T |
|
| Q |
301 |
atatttttcatatattacttgaaactcgcttgaga |
335 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41544140 |
atatttttcatatattatttgaaactcgcttgaga |
41544106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University