View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4713_high_7 (Length: 328)
Name: NF4713_high_7
Description: NF4713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4713_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 8e-55; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 27650088 - 27649959
Alignment:
| Q |
1 |
gattttcacgaaatggaagacggtgaacttgatttctcgaatcaagatgttttttcgagtcctaacatgggtgaatttcaaacaagtggttcaatggata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27650088 |
gattttcacgaaatggaagacggtgaacttgatttctcgaatcaagatgttttttcgagtcctaacatgggtgaatttcaaacaagtggttcaatggata |
27649989 |
T |
|
| Q |
101 |
gnnnnnnngatgaattgttgaaggatacac |
130 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
27649988 |
gtttttttgatgaattgttgaaggatacac |
27649959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 201 - 328
Target Start/End: Original strand, 27649961 - 27650088
Alignment:
| Q |
201 |
gtatccttcaacaattcatcnnnnnnnctatccattgaaccacttgtttgaaattcacccatgttaggactcgaaaaaacatcttgattcgagaaatcaa |
300 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27649961 |
gtatccttcaacaattcatcaaaaaaactatccattgaaccacttgtttgaaattcacccatgttaggactcgaaaaaacatcttgattcgagaaatcaa |
27650060 |
T |
|
| Q |
301 |
gttcaccgtcttccatttcgtgaaaatc |
328 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
27650061 |
gttcaccgtcttccatttcgtgaaaatc |
27650088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 177
Target Start/End: Original strand, 9491729 - 9491757
Alignment:
| Q |
149 |
ccctaaccctaaccctaaccctaacccta |
177 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9491729 |
ccctaaccctaaccctaaccctaacccta |
9491757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 148 - 176
Target Start/End: Complemental strand, 12279183 - 12279155
Alignment:
| Q |
148 |
accctaaccctaaccctaaccctaaccct |
176 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12279183 |
accctaaccctaaccctaaccctaaccct |
12279155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University