View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4714-Insertion-11 (Length: 172)
Name: NF4714-Insertion-11
Description: NF4714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4714-Insertion-11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 2e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 2e-81
Query Start/End: Original strand, 8 - 172
Target Start/End: Original strand, 10339118 - 10339282
Alignment:
| Q |
8 |
gaagatagggtaagaaataatttcttcatctttttggtgccaatcacttgtgctagaacggatggactaatacgaggtttatttatttgtaatgcagaca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10339118 |
gaagatagggtaagaaataatttcttcatcttttcggtaccaatcacttgcgctagaacggatggactaatacgaggtttatttatttgtaatgcagaca |
10339217 |
T |
|
| Q |
108 |
gctttgctatttttctttgctgttttctggggattctaccctctctacaatgcagttttcacatt |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10339218 |
gctttgctatttttctttgctgttttctggggattctaccctctctacaatgcagttttcacatt |
10339282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University