View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4714-Insertion-8 (Length: 258)
Name: NF4714-Insertion-8
Description: NF4714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4714-Insertion-8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 258
Target Start/End: Complemental strand, 42076508 - 42076261
Alignment:
| Q |
11 |
aacaaccaagtcaattctttaacaagcttctcgtaccttcccctgtttttatgaccctctgctttcgnnnnnnnggttatggcggttcatagcaaaaaca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42076508 |
aacaaccaagtcaattctttaacaagcttctcgtaccttcccctgtttttatgaccctctgctttcgtttttttggttatggcggttcatagcaaaaaca |
42076409 |
T |
 |
| Q |
111 |
tgttttccattgttctatctttgtggtcatggttgttgttgctgctcactctggacggtttacttgcaagaccgaaccgtctagagtgggaccctgtgat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42076408 |
tgttttccattgttctatctttgtggtcatggttgttgttgctgctcactctggacggtttagttgcaagaccgaaccatctagagtgggaccctgtgat |
42076309 |
T |
 |
| Q |
211 |
tagattgccgggtgaggtggtggatgatgctgaggtggatgaagttgg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42076308 |
tagattgccgggtgaggtggtggatgatgctgaggtggatgaagttgg |
42076261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University