View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4714_high_2 (Length: 415)
Name: NF4714_high_2
Description: NF4714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4714_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 115 - 407
Target Start/End: Complemental strand, 32082684 - 32082387
Alignment:
| Q |
115 |
gtttttctagcggtacgtaccattccattaacatt------catccatgcacattctttttatttattacgtatcaggtatcctcagcatgcaactgcaa |
208 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32082684 |
gtttttctagcggtacgtaccataccattaacattaacattcatccatgcacattctttttatttattacgtatcaggtatcctctgcatgcaactgcaa |
32082585 |
T |
|
| Q |
209 |
cataaaatatttttatatgatatgattttgnnnnnnngatcaggtttggagatgaggaatggtgatggattaaagatgccaaagttcgttgtaattggac |
308 |
Q |
| |
|
| |||||||| ||||| ||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32082584 |
cgtaaaatatctttatttgatatgattttgtttttt-gatcaggtttggagatgagcaatggtgatggattaaagatgccaaagttcgttgtaattggac |
32082486 |
T |
|
| Q |
309 |
atagaggaaacggtatgaatgtcttacaatctacggatcggagaatgagagccatcaaagaaaactccattatgtcttttaatgctgcttcttcttttc |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32082485 |
atagaggaaacggtatgaatgtcttacaatctacggatcggagaatgagagccatcaaagaaaactccattatgtcttttaatgctgcttcttcttttc |
32082387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 17 - 51
Target Start/End: Complemental strand, 32082782 - 32082748
Alignment:
| Q |
17 |
tctttctcctaacatggctctcaaagccgtccatg |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32082782 |
tctttctcctaacatggctctcaaagccgtccatg |
32082748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University