View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4714_high_4 (Length: 366)
Name: NF4714_high_4
Description: NF4714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4714_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 91 - 352
Target Start/End: Original strand, 38887042 - 38887306
Alignment:
| Q |
91 |
gatgggtgaaaaccttccataaatataaatataaatttgtatatggttctttcttat---tagaggaaattgtggaacatttaagatatatgatagctag |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38887042 |
gatgggtgaaaaccttccataaatataaatataaatttgtatatggttctttcttattattagaggaaatagtggaacatttaagatatatgatagctag |
38887141 |
T |
 |
| Q |
188 |
ggttggctttaatgataaaggaaaggttgtagattgttggttgtttttggtgaaaaagaaaaggaagtgaaatgtttgtggaaaagaacgcttttaggga |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38887142 |
ggttggctttaatgataaaggaaaggttatagattgttggttgtttttggtgaaaaagaaaaggaagtgaaatgtttgtggaaaagaacgcttttaggga |
38887241 |
T |
 |
| Q |
288 |
agcacctaagaggggaaagggtgaaaaaggtagctaggttttggaaggatagttggtggtgattg |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38887242 |
agcacctaagaggggaaagggtgaaaaaggtagctaggttttggaaggatagttggtggtgattg |
38887306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University