View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4714_high_9 (Length: 246)
Name: NF4714_high_9
Description: NF4714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4714_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 40243889 - 40244124
Alignment:
| Q |
1 |
caatttttaaaggcaatttcgtattggctaatcatcactaaaccgtctgtgacgccgtgagtcgtattcataatcaagcatatccttagagggatccatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40243889 |
caatttttaaaggcaatttcgtattggctaatcatcactaaaccgtctgtgacaccgtgagtcgtattcataatcaagcatatccttagagggatccatg |
40243988 |
T |
 |
| Q |
101 |
atgcttttcattgtcaaatttatttgtctaaaaatacattcatttttccgtagtatttcacatattgnnnnnnnnc-tcaagtaatttagtgactaaaaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
40243989 |
atgcttttcattgtcaaatttatttgtctaaaaatacattcatttttccgtagtatttcacatattattttttttcttcaagtaatttagtgactaaaaa |
40244088 |
T |
 |
| Q |
200 |
tttatctatttagatgaatggggtgtcctatatcat |
235 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
40244089 |
tttatctattaagatgaatggggtgttctatatcat |
40244124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University