View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4714_low_7 (Length: 288)
Name: NF4714_low_7
Description: NF4714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4714_low_7 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 13 - 288
Target Start/End: Original strand, 3398747 - 3399029
Alignment:
| Q |
13 |
agagatcaaataatttcaatttggttatgattacttctataaaaattatgaacattgtattttatttttgaaatcacttggttttataatgagaccgaac |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3398747 |
agagatcaaataatttcaatttcgttatgattacttctataaaaattatgaacattgtattttatttttgaaatcacttggttttataatgagaccgaac |
3398846 |
T |
 |
| Q |
113 |
tagagttacaaaatacttttnnnnnnnctatgaacattcta-------nnnnnnnnnnnnngaataaattagttttataattggatgacgaaaatatgca |
205 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3398847 |
tagagttacaaaatacttttaaaaaaactatgaacattctattttttttattttttttttggaataaattggttttataattggatgacgaaaatatgca |
3398946 |
T |
 |
| Q |
206 |
tttgattcttgcaaatataacaagttttgattttggtccatgcaatttgttttattaaaacccctgcaaaaagaaaaatattt |
288 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
3398947 |
tttgattcttgtaaatataataaattttgattttggtccatgcaatttgttttattcacacccctgcaaaatgaaaaatattt |
3399029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University