View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4714_low_8 (Length: 273)
Name: NF4714_low_8
Description: NF4714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4714_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 2 - 107
Target Start/End: Original strand, 3398959 - 3399064
Alignment:
| Q |
2 |
aaatataacaagttttgatttttgtccatgcaatttgttttattcaaacccctgcaaaatgaaaaatattttaaaaaggtcattgacatgaatttcctac |
101 |
Q |
| |
|
|||||||| || |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3398959 |
aaatataataaattttgattttggtccatgcaatttgttttattcacacccctgcaaaatgaaaaatattttaaaaaagtcattgacatgaatttcctac |
3399058 |
T |
 |
| Q |
102 |
taattt |
107 |
Q |
| |
|
|||||| |
|
|
| T |
3399059 |
taattt |
3399064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 121 - 254
Target Start/End: Original strand, 3399504 - 3399618
Alignment:
| Q |
121 |
gctgagagaaatgctttacatgatgaaacaaacttcgatgattgatgcttcatattgaatgtctttctctaagaaataaaatgtgggttgcggtggtggt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
3399504 |
gctgagagaaatgctttacatgatgaaacaaacttcgatgatcaatgcttcatattgaa----------------ataaaatgtgggttg---tggtggt |
3399584 |
T |
 |
| Q |
221 |
gtaatcattacaatataattgagatatagtaaca |
254 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||| |
|
|
| T |
3399585 |
gtaatcatcacaacataattgagatatagtaaca |
3399618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University