View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4715_high_2 (Length: 253)
Name: NF4715_high_2
Description: NF4715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4715_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 6 - 182
Target Start/End: Original strand, 52449606 - 52449782
Alignment:
| Q |
6 |
agaatattgtttctggtgatggcgttgttgttttttctatgtctgatgtgcctttgggttttggggtggctgctaagtctacacaggattgtaggaagtt |
105 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52449606 |
agaatattgtttctggtgatggggttgttgttttttctatgtctgatgtgcctttgggttttggggtggctgctaagtctacacaggattgtaggaagtt |
52449705 |
T |
 |
| Q |
106 |
ggatcctaatggtattgttgtgcttcatcagggtgatattggagagtatttgaggattgaggatgagctttgaaaag |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52449706 |
ggatcctaatggtattgttgtgcttcatcagggtgatattggagagtatttgaggattgaggatgagctttgaaaag |
52449782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 217 - 252
Target Start/End: Original strand, 52449817 - 52449852
Alignment:
| Q |
217 |
atgaaatttgagtcgtgggttatcgtcgtaatggtt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52449817 |
atgaaatttgagtcgtgggttatcgtcgtaatggtt |
52449852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University