View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4716-Insertion-10 (Length: 165)
Name: NF4716-Insertion-10
Description: NF4716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4716-Insertion-10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 3e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 3e-80
Query Start/End: Original strand, 8 - 162
Target Start/End: Original strand, 595850 - 596004
Alignment:
| Q |
8 |
aatgaggccggcggtggtattcaggtttgcgcttttgataatcggggcgttggtcggagctccgtacccattagaaagtccgattactcgtatgttcttc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
595850 |
aatgaggccggcggtggtattcaggtttgcgcttttgataatcggggcgttggtcggagctccgtgcccattagaaagtccgattactcgtatgttcttc |
595949 |
T |
|
| Q |
108 |
cacctttttcatttcattgctataaaattgagtttattgaatgtaattacactag |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
595950 |
cacctttttcatttcattgctataaaattgagtttattgaatgtaattacactag |
596004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 30 - 87
Target Start/End: Complemental strand, 30058379 - 30058322
Alignment:
| Q |
30 |
aggtttgcgcttttgataatcggggcgttggtcggagctccgtacccattagaaagtc |
87 |
Q |
| |
|
|||||| |||||||||| || ||||||| ||||||||||| |||| || ||||||||| |
|
|
| T |
30058379 |
aggttttcgcttttgatcattggggcgtgggtcggagctctgtacacaatagaaagtc |
30058322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University