View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4716-Insertion-14 (Length: 281)
Name: NF4716-Insertion-14
Description: NF4716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4716-Insertion-14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 8 - 281
Target Start/End: Original strand, 32259198 - 32259471
Alignment:
| Q |
8 |
atggtcgcattgcaaatccaagcaaacatttaattaattggtttgatattgatctatcaatggaggagaccttacgaggcaacggaaatgtctcactttc |
107 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32259198 |
atggtcgcatcacaaatccaagcacacatttaattaattggtttgatattgatctatcaatggaggagaccttacgaggcaacggaaatgtctcactttc |
32259297 |
T |
|
| Q |
108 |
atttaattcccagggggtgttgaaaatttgtgtaaaaaatgatagaaatgttggctcttatggcattttttctggagataatccatttgatttcactctt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32259298 |
atttaattcccagggggtgttgaaaatttgtgtaaaaaatgatagaaatgttggctcttatggcattttttctggagataatccattcgatttcactctt |
32259397 |
T |
|
| Q |
208 |
ccggcaacattgttccaaatcatcgttattgtcgtcctctctcaaactctttactttcttctcaggccattacg |
281 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32259398 |
ccggcaacattgttccaaatcatcattattgtcgtcctctctcaaactctttactttcttctcaggccattacg |
32259471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University