View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4716-Insertion-15 (Length: 184)
Name: NF4716-Insertion-15
Description: NF4716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4716-Insertion-15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 7e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 7e-91
Query Start/End: Original strand, 8 - 184
Target Start/End: Complemental strand, 29224047 - 29223871
Alignment:
| Q |
8 |
gaaaatatgtttatgttgttgttgattgatttttgggtttcattggacatgttttacttcaattgttatagagaaatttgtataagtgctattactttga |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29224047 |
gaaaatacgtttatgttgttgttgattgatttttgggtttcattggacatgttttacttcaattgctatagagaaatttgtataagtgctattactttga |
29223948 |
T |
 |
| Q |
108 |
acttctaaaagtgtactagtcttttattgatcatattcccatggccttaaaagtacctctaatttttattactatta |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29223947 |
acttctaaaagtgtactagtcttttattgatcatattcccatggccttaaaagtacctctaatttttattactatta |
29223871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University