View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4716-Insertion-18 (Length: 82)

Name: NF4716-Insertion-18
Description: NF4716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4716-Insertion-18
NF4716-Insertion-18
[»] chr2 (2 HSPs)
chr2 (7-43)||(40834794-40834830)
chr2 (35-66)||(40834843-40834874)


Alignment Details
Target: chr2 (Bit Score: 37; Significance: 0.000000000002; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 7 - 43
Target Start/End: Original strand, 40834794 - 40834830
Alignment:
7 acatgaaaacaagattaagcttctccaccaaaatcca 43  Q
    |||||||||||||||||||||||||||||||||||||    
40834794 acatgaaaacaagattaagcttctccaccaaaatcca 40834830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 35 - 66
Target Start/End: Original strand, 40834843 - 40834874
Alignment:
35 caaaatccaaacttccactttactgattttcc 66  Q
    |||||||||||||||||||||||| |||||||    
40834843 caaaatccaaacttccactttactcattttcc 40834874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University