View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4716-Insertion-5 (Length: 513)
Name: NF4716-Insertion-5
Description: NF4716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4716-Insertion-5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 49; Significance: 8e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 30 - 113
Target Start/End: Original strand, 24206697 - 24206778
Alignment:
| Q |
30 |
acaacatttgtgtcttttactggtgataattcaaatcaatacaactcataagttgaagattccaaatccgtgttgattatttgg |
113 |
Q |
| |
|
|||||||||||||| || | | |||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
24206697 |
acaacatttgtgtccttcagtagtgataattcaaatcaatacaactcatacattga--attccaaatccgtgttgattatttgg |
24206778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University