View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4716-Insertion-9 (Length: 169)
Name: NF4716-Insertion-9
Description: NF4716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4716-Insertion-9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 9e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 9e-87
Query Start/End: Original strand, 8 - 169
Target Start/End: Complemental strand, 1357387 - 1357226
Alignment:
| Q |
8 |
acacgtgtcacttgatccaataattaaggataaattgctaacagaaatggatataaaaggagaaaggatgaattatgggaaggcatgaaaataatatgga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1357387 |
acacgtgtcacttgatccaataattaaggataaattgctaacagaaatggatataaaaggagaaaggatgaattatgggaaggcatgaaaataatatgga |
1357288 |
T |
 |
| Q |
108 |
ttgaagtctctatttctccctctgaatattcttctctgtttcttatccccttcttttgtact |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1357287 |
ttgaagtctctatttctccctctgaatattcttctctgtttcttatccccttcttttgtact |
1357226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 42 - 127
Target Start/End: Complemental strand, 15435066 - 15434983
Alignment:
| Q |
42 |
ttgctaacagaaatggatataaaaggagaaaggatgaattatgggaag-gcatgaaaataatatggattgaagtctctatttctccc |
127 |
Q |
| |
|
||||||| ||||||||||||||| |||||||| ||||| ||| || | ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15435066 |
ttgctaagagaaatggatataaa-ggagaaagtctgaatgatgtgaggagcatgaaaataat--ggattgaagtctctatttctccc |
15434983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University