View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4716_high_20 (Length: 250)
Name: NF4716_high_20
Description: NF4716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4716_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 3546046 - 3545871
Alignment:
| Q |
1 |
ttgccattcttacagaattgttctttcatattaagtggcataatgtttttcagttagattat---------------gtttttcagtaaagaatggtgtt |
85 |
Q |
| |
|
|||||| ||| |||||| ||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
3546046 |
ttgccactctgacagaagtgtgctttcatattaagtggcataatgtttttcagttagattatttttggttagattatgtttttcagtaaagaatggtgat |
3545947 |
T |
|
| Q |
86 |
ataagttgtaacttgtattcaataaccattcaacaatagtgttgtaatgtgcatctttgtggggatatctcgtata |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3545946 |
ataagttgtaacttgtattcaataaccattcaacaatagtgttgtaatgtgcatctatgtggggatatctcgtata |
3545871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 160 - 234
Target Start/End: Complemental strand, 3545836 - 3545762
Alignment:
| Q |
160 |
taagttaatgtttcaataagaaagattctcgcaccttggttacttgtaatgtgcatcaaaatttgatgttggtta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3545836 |
taagttaatgtttcaataagaaagattctcacaccttggttacttgtaatgtgcatcaaaatttgatgttggtta |
3545762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University