View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4716_high_9 (Length: 353)
Name: NF4716_high_9
Description: NF4716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4716_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 1e-35; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 234 - 337
Target Start/End: Complemental strand, 308183 - 308080
Alignment:
| Q |
234 |
atataaaatgattgtagtcatcaatcagtattgtttgttggttgatttaagtgatannnnnnnnngtggtcgaggtttgaactccggactttacatattt |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
308183 |
atataaaatgattgtagtcatcaatcagtattgtttgttggttgatttaagtgatatttttttttgtggtcgaggtttgaactccggactttacatattt |
308084 |
T |
|
| Q |
334 |
tatg |
337 |
Q |
| |
|
|||| |
|
|
| T |
308083 |
tatg |
308080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 115 - 208
Target Start/End: Complemental strand, 1503917 - 1503823
Alignment:
| Q |
115 |
aaatgatttaagaattttta-aaaaacctactttacaacataatgaaatgtttaattttagaagaacttgctatatttggataaactttttggtt |
208 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
1503917 |
aaatgatttacgaatttttttaaaaacctactttacaacataatgaaatgtttcattttagaagaacttgctatatttggattaactttctggtt |
1503823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 4 - 77
Target Start/End: Complemental strand, 1504003 - 1503929
Alignment:
| Q |
4 |
agtgagatgaaataatgtgtgattgttttttgggggaagggggag-tgttatgcaacttctatgataaggttata |
77 |
Q |
| |
|
||||| |||| ||||||||| |||||||||| ||||| ||||| | |||||||||| ||| |||||||||||||| |
|
|
| T |
1504003 |
agtgacatgagataatgtgttattgtttttttggggagggggggggtgttatgcaatttcaatgataaggttata |
1503929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University