View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4716_low_10 (Length: 353)

Name: NF4716_low_10
Description: NF4716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4716_low_10
NF4716_low_10
[»] chr7 (3 HSPs)
chr7 (234-337)||(308080-308183)
chr7 (115-208)||(1503823-1503917)
chr7 (4-77)||(1503929-1504003)


Alignment Details
Target: chr7 (Bit Score: 77; Significance: 1e-35; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 234 - 337
Target Start/End: Complemental strand, 308183 - 308080
Alignment:
234 atataaaatgattgtagtcatcaatcagtattgtttgttggttgatttaagtgatannnnnnnnngtggtcgaggtttgaactccggactttacatattt 333  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||||    
308183 atataaaatgattgtagtcatcaatcagtattgtttgttggttgatttaagtgatatttttttttgtggtcgaggtttgaactccggactttacatattt 308084  T
334 tatg 337  Q
    ||||    
308083 tatg 308080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 115 - 208
Target Start/End: Complemental strand, 1503917 - 1503823
Alignment:
115 aaatgatttaagaattttta-aaaaacctactttacaacataatgaaatgtttaattttagaagaacttgctatatttggataaactttttggtt 208  Q
    |||||||||| ||||||||  |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||    
1503917 aaatgatttacgaatttttttaaaaacctactttacaacataatgaaatgtttcattttagaagaacttgctatatttggattaactttctggtt 1503823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 4 - 77
Target Start/End: Complemental strand, 1504003 - 1503929
Alignment:
4 agtgagatgaaataatgtgtgattgttttttgggggaagggggag-tgttatgcaacttctatgataaggttata 77  Q
    ||||| |||| ||||||||| |||||||||| ||||| ||||| | |||||||||| ||| ||||||||||||||    
1504003 agtgacatgagataatgtgttattgtttttttggggagggggggggtgttatgcaatttcaatgataaggttata 1503929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University