View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4716_low_23 (Length: 242)
Name: NF4716_low_23
Description: NF4716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4716_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 16 - 240
Target Start/End: Complemental strand, 4384923 - 4384699
Alignment:
| Q |
16 |
cagtagcagtatgcagataagaagcatgtacatgatacatactacatagtactcgatatctggtttgactatgagcagttcgtttgtgttggattggtag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4384923 |
cagtagcagtatgcagataagaagcatgtacatgatacatactacatagtactcgatatctggtttgactatgagcagttcgtttgtgttggattggtag |
4384824 |
T |
 |
| Q |
116 |
agaaaatatgtacatgataatgatacaaggttgtgctttcagctgtcattctttcaggaatgaatgactactcactgatttgtggaagatgcatgcataa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4384823 |
agaaaatatgtacatgataatgatacaaggttgtgctttcagctgtcattctttcaggaatgaatgactactcactgatttgtggaagatgcatgcatag |
4384724 |
T |
 |
| Q |
216 |
ggaggtagcttgaggtcctatgcta |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
4384723 |
ggaggtagcttgaggtcctatgcta |
4384699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University