View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4716_low_27 (Length: 235)
Name: NF4716_low_27
Description: NF4716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4716_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 23242830 - 23242611
Alignment:
| Q |
1 |
atttcgttatccaaaaaactctagcggcacaacttattgttcacttgcctttaaaaattgaattgttaaatcttaatcaaacaattgaatgaagatatat |
100 |
Q |
| |
|
|||| |||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23242830 |
attttgttatccaaaaagctctaacggcacaacttattgttcgcttgcctttaaaaattgaattgttgaatcttaatcaaacaattgaatgaagatatat |
23242731 |
T |
|
| Q |
101 |
taatttcatatgcatgtgggataattatcttcgtcaatgaataatttgttgtctcaacaaaggagccacaagtgcaccggttcacacctcacagtatgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23242730 |
taatttcatatgcatgtgggataattatcttcgtcaatgaataatttgttgtctcaacaaaggagccacaagtgcaccggttcacacttcacagtatgaa |
23242631 |
T |
|
| Q |
201 |
ataagaattgtattttgatt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
23242630 |
ataagaattgtattttgatt |
23242611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 92
Target Start/End: Original strand, 23233333 - 23233381
Alignment:
| Q |
44 |
cttgcctttaaaaattgaattgttaaatcttaatcaaacaattgaatga |
92 |
Q |
| |
|
||||||||||||| |||||||| |||||| ||||||||||||||||| |
|
|
| T |
23233333 |
cttgcctttaaaatctgaattgtcgaatcttcatcaaacaattgaatga |
23233381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University