View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4717-Insertion-13 (Length: 375)
Name: NF4717-Insertion-13
Description: NF4717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4717-Insertion-13 |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0050 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 327 - 375
Target Start/End: Original strand, 8131 - 8179
Alignment:
| Q |
327 |
gtacataactaatgacagccgatttagaaataaaaatttcttccactca |
375 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
8131 |
gtacataactaatgacaaccaatttagaaataaaaatttcttccactca |
8179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 180 - 246
Target Start/End: Original strand, 29500350 - 29500416
Alignment:
| Q |
180 |
gattattctacatctcatttccacttattttaaaatatattactgatattacttccatgtttatttt |
246 |
Q |
| |
|
|||||||||| |||||||||||| |||| | |||||| |||||||| || ||||||||||||||||| |
|
|
| T |
29500350 |
gattattctatatctcatttccatttatgtgaaaataaattactgacataacttccatgtttatttt |
29500416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 197 - 258
Target Start/End: Complemental strand, 24779252 - 24779190
Alignment:
| Q |
197 |
tttccacttattttaaaatatattactgatattacttccatgttta-ttttcgttatttattt |
258 |
Q |
| |
|
|||||| ||||||||||||| | || ||| |||||||||||||||| |||||||||| ||||| |
|
|
| T |
24779252 |
tttccatttattttaaaataaactattgaaattacttccatgtttatttttcgttatatattt |
24779190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University