View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4717-Insertion-15 (Length: 123)
Name: NF4717-Insertion-15
Description: NF4717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4717-Insertion-15 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
| [»] scaffold0057 (2 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 2e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 8 - 123
Target Start/End: Original strand, 3352204 - 3352319
Alignment:
| Q |
8 |
ctcataccatatttggaagctatggaatagattgttcctttaacaccgataacaacgaagcattcatcttttatgaaaacttttgtgctctcatagacta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3352204 |
ctcataccatatttggaagctatggaatagattgttcctttaacaccgataacaacgaagcattcatcttttatgaaaacttttgtgctctcatagacta |
3352303 |
T |
|
| Q |
108 |
tgcaccatactcgggc |
123 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3352304 |
tgcaccatactcgggc |
3352319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 3e-21
Query Start/End: Original strand, 24 - 119
Target Start/End: Complemental strand, 42046374 - 42046279
Alignment:
| Q |
24 |
aagctatggaatagattgttcctttaacaccgataacaacgaagcattcatcttttatgaaaacttttgtgctctcatagactatgcaccatactc |
119 |
Q |
| |
|
|||||||| ||| |||||| | ||| |||||||||||||| | |||||||||||| ||||||| ||||||||||| ||||||||||| |||||||| |
|
|
| T |
42046374 |
aagctatgcaattgattgtgcatttgacaccgataacaaccaggcattcatctttcatgaaaatttttgtgctctaatagactatgctccatactc |
42046279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 14452485 - 14452596
Alignment:
| Q |
8 |
ctcataccatatttggaagctatggaatagattgttcctttaacaccgataacaacgaagcattcatcttttatgaaaacttttgtgctctcatagacta |
107 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||| ||||| |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14452485 |
ctcatacaatatttggaagctatggaattgattgtgcctttgacaccgataacaacgaggcattcatcttttatgaaaatttttgtgctctcatagacta |
14452584 |
T |
|
| Q |
108 |
tgcaccatactc |
119 |
Q |
| |
|
||||||| |||| |
|
|
| T |
14452585 |
tgcaccacactc |
14452596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 63; Significance: 8e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 8e-28
Query Start/End: Original strand, 8 - 110
Target Start/End: Complemental strand, 42471577 - 42471475
Alignment:
| Q |
8 |
ctcataccatatttggaagctatggaatagattgttcctttaacaccgataacaacgaagcattcatcttttatgaaaacttttgtgctctcatagacta |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||| ||||| |||| ||||||| | | |||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
42471577 |
ctcataccgtatttggaagctatggaattgattgtgcctttgacacggataacacctaggcattcatattttatgaaaacctttgtgctctcatagacta |
42471478 |
T |
|
| Q |
108 |
tgc |
110 |
Q |
| |
|
||| |
|
|
| T |
42471477 |
tgc |
42471475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 36; Significance: 0.00000000001; HSPs: 2)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 18 - 81
Target Start/End: Complemental strand, 37514 - 37451
Alignment:
| Q |
18 |
atttggaagctatggaatagattgttcctttaacaccgataacaacgaagcattcatcttttat |
81 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||||||| ||||||| || ||| |||||||| |
|
|
| T |
37514 |
atttggaagcaatggaatagattgtgcctttgacaccgatgacaacgaggcgttcgtcttttat |
37451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 11 - 81
Target Start/End: Complemental strand, 63577 - 63507
Alignment:
| Q |
11 |
ataccatatttggaagctatggaatagattgttcctttaacaccgataacaacgaagcattcatcttttat |
81 |
Q |
| |
|
|||||| |||||||||| |||||||||||||| ||||| |||||||| |||| || || ||| |||||||| |
|
|
| T |
63577 |
ataccaaatttggaagcaatggaatagattgtgcctttgacaccgatgacaatgaggcgttcgtcttttat |
63507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University