View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4717_high_4 (Length: 227)
Name: NF4717_high_4
Description: NF4717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4717_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 23 - 209
Target Start/End: Complemental strand, 40253660 - 40253474
Alignment:
| Q |
23 |
tgcagggttgacctatgtgaaccagcaacaactagatggatcgatctcgacttcgacagaaagcagtagttggggagatatgagttctttgattcactca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40253660 |
tgcagggttgacctatgtgaaccagcaacaactagatggatcgatctcgacttcgacagaaagcagtagttggggagatatgagttctttgattcactca |
40253561 |
T |
|
| Q |
123 |
cctttggcttctgattatgaaggtgaccaccaacaaacaatgattcaagaagattttacttttgaggagtctatgttctaaggaatg |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
40253560 |
cctttggcttctgattatgaaggtggccaccaacaaacaatgattcaagaagattttacttttgacgagtctatgttctatggaatg |
40253474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 72 - 146
Target Start/End: Original strand, 5114371 - 5114445
Alignment:
| Q |
72 |
acttcgacagaaagcagtagttggggagatatgagttctttgattcactcacctttggcttctgattatgaaggt |
146 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||| |||||| || |||||||||||| |||||||||||||||| |
|
|
| T |
5114371 |
acttcaacagaaagcactagttggggagatatgaactctttggtttactcacctttggtttctgattatgaaggt |
5114445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University