View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4717_low_4 (Length: 250)
Name: NF4717_low_4
Description: NF4717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4717_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 37843001 - 37843122
Alignment:
| Q |
1 |
attgggaatgaagatggagttgccggagattctccatacggtggttttggcatcttccggtgagagaggtcttgcacggacggtgacgtgaattctctcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37843001 |
attgggaatgaagatggagttgccggagattctccatacggtggttttggcatcttccggtgagagaggtcttgcacggacggtgacgtgaattctctcc |
37843100 |
T |
 |
| Q |
101 |
atggtgagagaatgaagaaaga |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37843101 |
atggtgagagaatgaagaaaga |
37843122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 186 - 243
Target Start/End: Original strand, 37843180 - 37843237
Alignment:
| Q |
186 |
gtgtgacgaatttggactagaagtaagtacccaagacttgttcgttcctcctttggta |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37843180 |
gtgtgacgaatttggactagaagtaagtacccaagacttgttcgttcctcctttggta |
37843237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University